ID: 1082283645

View in Genome Browser
Species Human (GRCh38)
Location 11:50298147-50298169
Sequence CTGGCTGGGGGAGGTGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082283633_1082283645 -6 Left 1082283633 11:50298130-50298152 CCGGGGGTCCCCGGGCCCTGGCT No data
Right 1082283645 11:50298147-50298169 CTGGCTGGGGGAGGTGTTGTGGG No data
1082283618_1082283645 30 Left 1082283618 11:50298094-50298116 CCAGGATGAGTGGCGCCAGGTAG No data
Right 1082283645 11:50298147-50298169 CTGGCTGGGGGAGGTGTTGTGGG No data
1082283624_1082283645 15 Left 1082283624 11:50298109-50298131 CCAGGTAGCGGGGGGACGCTCCC No data
Right 1082283645 11:50298147-50298169 CTGGCTGGGGGAGGTGTTGTGGG No data
1082283632_1082283645 -5 Left 1082283632 11:50298129-50298151 CCCGGGGGTCCCCGGGCCCTGGC No data
Right 1082283645 11:50298147-50298169 CTGGCTGGGGGAGGTGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082283645 Original CRISPR CTGGCTGGGGGAGGTGTTGT GGG Intergenic
No off target data available for this crispr