ID: 1082285652

View in Genome Browser
Species Human (GRCh38)
Location 11:50315406-50315428
Sequence TTTTTTCAGCTGAAGCCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 254}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082285652 Original CRISPR TTTTTTCAGCTGAAGCCTTG GGG Intergenic
903595512 1:24490873-24490895 TTTTATGAGCTGAAGCCTCATGG + Intergenic
904804792 1:33123162-33123184 TTTCTTTAGGTGAAGCCTTCTGG + Intergenic
905226697 1:36483272-36483294 TCTTTTCAGCTCTAGCCTTGGGG + Exonic
909127608 1:71694133-71694155 TGTTCTTAGCAGAAGCCTTGTGG - Intronic
913530849 1:119733218-119733240 TTTTTTCATCATTAGCCTTGTGG - Intronic
914340573 1:146756315-146756337 TTTTTTCATCCTAAGCATTGTGG - Intergenic
914414529 1:147468046-147468068 TTTTTTAAGTTGAAGCTTTGTGG + Intergenic
914748307 1:150515269-150515291 TTCTTTCAGATCCAGCCTTGAGG - Intergenic
915796789 1:158743856-158743878 TTTTTTGAGATGAAGTGTTGGGG + Intergenic
918270327 1:182892132-182892154 GTTTTTCTGCTGGAGTCTTGAGG - Intergenic
918288309 1:183080535-183080557 TTCCCTCAGCTGCAGCCTTGGGG + Intronic
919315672 1:195968366-195968388 TTTACAAAGCTGAAGCCTTGAGG + Intergenic
919839746 1:201600166-201600188 TTTTCTCTGCTCCAGCCTTGGGG - Intergenic
921012868 1:211160716-211160738 TTTTTGGAGTTGAAGCTTTGGGG + Intergenic
922554039 1:226519527-226519549 TTCTTTCAGCTGCAGTCATGTGG + Intergenic
922758825 1:228111581-228111603 TATTTGCAGATGAAGCCTTCAGG + Intergenic
923398360 1:233590180-233590202 TTTTTGCATCAGGAGCCTTGGGG - Intergenic
1067080386 10:43209218-43209240 ATTCTTCAACTGTAGCCTTGCGG - Intronic
1069298347 10:66875285-66875307 ATTTTTCAGCTGTAGCCTTTTGG - Intronic
1069657661 10:70102081-70102103 TATTTTCCTCTGAAGCCCTGCGG - Intronic
1071340903 10:84647538-84647560 GTTTTTCAGCTGAGGCGATGGGG + Intergenic
1073561685 10:104502450-104502472 TTGTCTCAGCTGATGCCATGTGG - Intergenic
1074194134 10:111165560-111165582 TTTTTTGAGCTGTGGCCATGGGG + Intergenic
1074409005 10:113208070-113208092 TTTTTTCAGCAGAAACTTTGCGG + Intergenic
1077693409 11:4370343-4370365 TTCTTTCAGAAGAACCCTTGAGG + Intergenic
1078562715 11:12387328-12387350 TTTTTTCTGCAGATGCCATGAGG + Intronic
1080910009 11:36586882-36586904 TTTTTGTATCTGAAGTCTTGGGG + Intronic
1081809137 11:45905556-45905578 GTTTTCCCGCTGGAGCCTTGGGG - Intronic
1082285652 11:50315406-50315428 TTTTTTCAGCTGAAGCCTTGGGG + Intergenic
1084448806 11:69220439-69220461 TTTTTTAAGTTGAAGACATGAGG + Intergenic
1087160207 11:94941227-94941249 TTATTTCAGAAGAAGCCTAGTGG + Intergenic
1089131845 11:116218549-116218571 TGTGTTCTGCTGATGCCTTGTGG - Intergenic
1089314468 11:117582190-117582212 TTATTTCAGCTGCTGCTTTGTGG + Intronic
1090604836 11:128410746-128410768 TTTTATAAGTTGAAGCCTTCAGG - Intergenic
1090685034 11:129107112-129107134 TTTTCTCAGCTGAAATGTTGAGG + Intronic
1091402055 12:187100-187122 TTTTTGCAGCAGAAGCCCTGAGG - Intergenic
1091650704 12:2307038-2307060 TGGTCTCAGCTGAAGCCATGAGG + Intronic
1092484942 12:8894501-8894523 TGTTTTAAGATGAAGCTTTGTGG - Intergenic
1093375001 12:18415175-18415197 TTTTTACAACTGAAGATTTGTGG + Intronic
1095486026 12:42685530-42685552 TATTGTCAGCAGAAGCCTGGTGG + Intergenic
1097884386 12:64714113-64714135 TTTTTTGAGATGAAGTCTCGCGG - Exonic
1097932655 12:65206569-65206591 TTTTTTAAACTGATGCCATGTGG + Intronic
1098527699 12:71505183-71505205 ATTTTTCTACTGAAGCCTTGAGG - Intronic
1099033348 12:77556303-77556325 TATGTGCAGCTGAAACCTTGAGG + Intergenic
1101432044 12:104634816-104634838 GTTTTTCAGCTGAAGGTGTGGGG - Intronic
1103520904 12:121536706-121536728 TGTGTTCAGCTGAGGCCTGGAGG - Intronic
1105449083 13:20482708-20482730 TATTTTTAGTTGAAGCATTGTGG + Intronic
1106471977 13:30064211-30064233 TATTTTAAGCTGAAGGCATGTGG - Intergenic
1106876688 13:34082207-34082229 TCCTTTCAGCTGTAGACTTGGGG - Intergenic
1108771354 13:53704913-53704935 TTATTTCAGCTGAAGTCTGTGGG - Intergenic
1109411518 13:61975650-61975672 TTTTTCCAGCAATAGCCTTGAGG - Intergenic
1109530276 13:63633916-63633938 TCTTTTCAGAGGAAGGCTTGTGG + Intergenic
1109864161 13:68240592-68240614 TTTTTTGAACTCAAGGCTTGTGG + Intergenic
1110020905 13:70470657-70470679 TTTTTTCAACTCCAGCATTGTGG + Intergenic
1110760067 13:79221859-79221881 TGTTCTCATGTGAAGCCTTGAGG - Intergenic
1111247313 13:85556667-85556689 TTTTGTCAACTGAAACTTTGAGG - Intergenic
1111575508 13:90148742-90148764 TATTTTAATCTGAAGGCTTGAGG - Intergenic
1112890600 13:104225861-104225883 ATTTTTCAGCTGAAATCATGAGG + Intergenic
1115382312 14:32754839-32754861 ATTTTTCAGCAGAAACTTTGCGG - Intronic
1117569227 14:57029782-57029804 CTTTCTCAGCTGGAGCCTTAAGG + Intergenic
1117965288 14:61201293-61201315 TTTTTTCAGATGAAAAATTGAGG + Intronic
1120541804 14:85760347-85760369 TTTTATCAGCAGAAACCTGGAGG - Intergenic
1120974361 14:90235681-90235703 TTTTTTCAAATGAAGCGTTTAGG - Intergenic
1122135995 14:99633307-99633329 TGGTTTCAGCTGCAGCCTCGGGG + Intergenic
1122465831 14:101932860-101932882 TTGCTTTAGCTCAAGCCTTGGGG - Intergenic
1125424114 15:39532737-39532759 TTTTTTTAGATCAAGCCTAGTGG + Intergenic
1125433226 15:39618859-39618881 GGTATTCAGCTGAAGTCTTGTGG - Intronic
1128672173 15:69581913-69581935 ATTTTTCAGATTAAGCTTTGAGG + Intergenic
1130614669 15:85393354-85393376 TTTGATCACATGAAGCCTTGGGG + Intronic
1131598217 15:93821093-93821115 TCTTTTCTGCTGTAGCCTTCTGG - Intergenic
1134462812 16:14444354-14444376 TTTTTTTAGCTCAAATCTTGTGG + Intronic
1135172370 16:20197105-20197127 ATTTTTCAGGTGAAGCATGGAGG + Intergenic
1135313900 16:21427432-21427454 TTTTTTCAGCTGCATCCCTTGGG + Intronic
1135366824 16:21859712-21859734 TTTTTTCAGCTGCATCCCTTGGG + Intronic
1135444991 16:22511446-22511468 TTTTTTCAGCTGCATCCCTTGGG - Intronic
1136310564 16:29406134-29406156 TTTTTTCAGCTGCATCCCTTGGG + Intergenic
1136324011 16:29507919-29507941 TTTTTTCAGCTGCATCCCTTGGG + Intergenic
1136438696 16:30247902-30247924 TTTTTTCAGCTGCATCCCTTGGG + Intronic
1138311760 16:56030171-56030193 ATTTCTCAGCTGAAACCATGGGG + Intergenic
1139993712 16:70961091-70961113 TTTTTTCATCCTAAGCATTGTGG + Intronic
1140222149 16:73051500-73051522 ATTTTTCTGCTGAAGCCTCAAGG + Intronic
1140422454 16:74831803-74831825 ATTTTTCAGCAGAAGCCATTTGG + Intergenic
1142796953 17:2315358-2315380 GTTTTTCTGGTGAAGCTTTGAGG - Intronic
1144372385 17:14604317-14604339 TTTTATCAGATGAAGCCTCCAGG - Intergenic
1147485558 17:40809360-40809382 TTTTATCAGCTGATTTCTTGTGG - Intergenic
1147911323 17:43857937-43857959 TTCTTGCAGCAGTAGCCTTGGGG - Intronic
1148770499 17:50063409-50063431 TTTTTCCTCCTGAAGCCATGTGG - Intronic
1149818087 17:59746767-59746789 TTTTTTCTGCTGATGGCTTACGG + Intronic
1150425897 17:65076855-65076877 TTTTTTTAGCTAGAGCCATGAGG + Intergenic
1153913776 18:9727166-9727188 TTCTTCCAGCTGTAGCCATGTGG + Intronic
1154119694 18:11641792-11641814 TTTTTTCAGCTGCATCCCTTGGG + Intergenic
1155372199 18:25113323-25113345 GGTTTTCATCTGAAGGCTTGGGG - Intronic
1155764056 18:29605523-29605545 TTTTTTCCTCCTAAGCCTTGAGG - Intergenic
1156957643 18:42987880-42987902 TCTTTTCAGCAAGAGCCTTGTGG + Intronic
1157617664 18:48996815-48996837 GCTTTTCAGGTGGAGCCTTGAGG - Intergenic
1158059882 18:53327291-53327313 TTTTTTAAGCTGAAATTTTGAGG - Intronic
1158864089 18:61620361-61620383 GGTTTGCAGCTGAAGGCTTGGGG - Intergenic
1159845001 18:73448420-73448442 TGTTTTCTGGTGAAGGCTTGCGG - Intergenic
1159902720 18:74063177-74063199 CTTTTTTAGTTGAAGCTTTGAGG + Intergenic
1161976269 19:7609469-7609491 CTTTTTGAGCTGAGGTCTTGGGG + Intronic
1163230276 19:15997262-15997284 GAGTTCCAGCTGAAGCCTTGGGG - Intergenic
1164011301 19:21205389-21205411 TGGTTTCAGCTGAGGCTTTGGGG + Intergenic
1164015729 19:21254572-21254594 TGGTTTCAGCTGAGGCTTTGGGG - Intronic
1167171593 19:47836038-47836060 CTTGTTGAGCTAAAGCCTTGGGG + Intronic
1167926778 19:52827587-52827609 TTTTTTGAGATGGAGTCTTGCGG + Intronic
1168367596 19:55802280-55802302 GTTTATCAGCTGAAGATTTGGGG - Intronic
925002321 2:415026-415048 ATTTTTCAGCAGAAACCTAGAGG - Intergenic
925469294 2:4141705-4141727 TTTCTTCAGATGATACCTTGAGG - Intergenic
925748069 2:7061338-7061360 AATATTCAGCTGAAGCCTGGTGG - Intronic
926066269 2:9843100-9843122 TTTTTTAAGGGGAAGCCTCGGGG - Intergenic
926808164 2:16732046-16732068 TTTTTTCAGATGAATCCTCCAGG + Intergenic
928679199 2:33681632-33681654 TTTTATCAGCTGAGTCTTTGGGG + Intergenic
929509110 2:42552933-42552955 TTTTTTGAGATGGAGTCTTGCGG - Intronic
930708972 2:54531946-54531968 TTTTACAAGCTGAAGACTTGAGG - Intronic
933003290 2:76954853-76954875 ATTTATCAGCAGAAACCTTGTGG + Intronic
935352067 2:102159620-102159642 TTTTTCCAGCAAACGCCTTGGGG + Intronic
937810579 2:126195189-126195211 TTATTGCAGCTGGAGTCTTGTGG + Intergenic
939579345 2:143929995-143930017 TTTCTTCAGCTGACCCCTTATGG - Intergenic
939877949 2:147599043-147599065 CTTTTTCTGCAGAAGCCTGGAGG + Intergenic
942069488 2:172303486-172303508 TTTTTTCAGCTGATGAATTATGG + Intergenic
942518093 2:176774350-176774372 TTTTTTCAGTTGGACCCCTGGGG + Intergenic
942639456 2:178046272-178046294 TTTTTGCAGCTGATCCTTTGAGG + Intronic
942887238 2:180940330-180940352 TGATTTCAGCTGAAGCTATGAGG - Intergenic
943180701 2:184537037-184537059 TATTTTCAGCTAAAGACTTTTGG - Intergenic
944394671 2:199253031-199253053 TTATTTTTGCTGAAGCCATGAGG - Intergenic
945214452 2:207418580-207418602 TTCTTTCTGCTGCAGCCCTGTGG + Intergenic
946230969 2:218291192-218291214 TTTTTACAAGTGAGGCCTTGAGG + Intronic
1170158524 20:13289869-13289891 TTTTTTCAGCCAAAGCCATTTGG - Intronic
1170229622 20:14030421-14030443 TTTTTTGAGATGGAGTCTTGTGG + Intronic
1170805760 20:19629704-19629726 ATTTCTCAGAAGAAGCCTTGCGG + Intronic
1170875813 20:20249028-20249050 TGTTTTCGGATGAAGCCTAGTGG + Intronic
1171474606 20:25398558-25398580 TTTTTGCAGCTGTAGCCTTGAGG + Intergenic
1172856474 20:38007547-38007569 TTTTTTGAAATGAAGCCTTTGGG - Intronic
1173621163 20:44437047-44437069 GTTTTTCAGCTGCAGCCAGGTGG + Intergenic
1173645748 20:44632155-44632177 ACATTTCAGCAGAAGCCTTGGGG + Intronic
1175119084 20:56704607-56704629 ATTTGTCAGCTGAGACCTTGAGG + Intergenic
1175305637 20:57973863-57973885 TTATTTCAGCTGAAGGCGCGAGG - Intergenic
1175459284 20:59139163-59139185 TATTTTCTGCTTAGGCCTTGAGG + Intergenic
1177764462 21:25440878-25440900 TTTTTGGTGTTGAAGCCTTGAGG - Intergenic
1181972491 22:26702542-26702564 TTTTGCCACCTCAAGCCTTGAGG + Intergenic
1182026244 22:27121479-27121501 GGTTTTCAGCTGAAGCCATTGGG - Intergenic
1182109969 22:27716107-27716129 TTGTCTCAGCTGATGCCATGTGG - Intergenic
1184015724 22:41784429-41784451 TTTCTTCTGCTGGAGACTTGTGG - Intronic
1184056765 22:42057558-42057580 TTTTTTCAGTTGAAGTTTTCTGG + Intronic
1184391903 22:44207592-44207614 GTTTGACAGCTGAGGCCTTGGGG + Exonic
949952610 3:9241692-9241714 TATTTGCAGGTGGAGCCTTGGGG + Intronic
954829201 3:53404251-53404273 TTTTCTCACCTGAAACCATGGGG + Intergenic
955831030 3:63004391-63004413 TTTTTTAAACTGAAGGTTTGTGG - Intergenic
957374504 3:79338553-79338575 TTTTGTCAGGTGAAGCATTAAGG + Intronic
957691504 3:83576730-83576752 ATGTTGCAGGTGAAGCCTTGTGG - Intergenic
957717529 3:83948908-83948930 TTTTTTCAGAAGAAGCCTGCAGG - Intergenic
957939140 3:86983099-86983121 TTTTGTAGGCTTAAGCCTTGGGG - Intronic
958744461 3:98115521-98115543 ATTTATCAGCAGAAACCTTGTGG - Intergenic
959160008 3:102711731-102711753 TTTCTTCAGCTGAATCTTTTGGG - Intergenic
960343009 3:116497861-116497883 ATTTTGCTGCTGAAGCTTTGGGG - Intronic
961246761 3:125460770-125460792 TTTTTTATGCAGAAGCATTGCGG - Exonic
961800628 3:129446138-129446160 TGTTTGCAGAGGAAGCCTTGAGG - Intronic
962496477 3:135945275-135945297 TTGCTTCAGCTCAGGCCTTGGGG + Intergenic
963312103 3:143720738-143720760 TTGTTTCAGCTGAAGACTACAGG - Intronic
963625261 3:147663840-147663862 ATTTGTGATCTGAAGCCTTGGGG - Intergenic
964035667 3:152193742-152193764 CTTCTACAGCTGAAGCTTTGTGG - Intergenic
964534941 3:157710468-157710490 TTTTTTCAGCTACATCCTTTAGG + Intergenic
964689642 3:159436040-159436062 ATTTTCCAGCTGAAGCTTTCAGG - Intronic
965248051 3:166301404-166301426 TTTTTTTAGCTGAAGCCCAAGGG + Intergenic
968097822 3:195944524-195944546 GTCTTGCAGCTGAAGACTTGGGG - Intergenic
968304680 3:197642103-197642125 GTCTTGCAGCTGAAGACTTGGGG - Intergenic
968304813 3:197643138-197643160 GTCTTGCAGCTGAAGACTTGGGG - Intergenic
968304942 3:197644125-197644147 GTCTTGCAGCTGAAGACTTGGGG - Intergenic
972554766 4:40170715-40170737 TTTTTTCAGCTGTATCTTTTTGG + Intergenic
973000680 4:44945342-44945364 TTTTATAAGTTGAAGGCTTGTGG + Intergenic
974973133 4:68855672-68855694 TTTTACAAGCTGAACCCTTGTGG + Intergenic
975027159 4:69564452-69564474 TTTTTTTTGGTGAAGCCTTCAGG - Intergenic
975286815 4:72631018-72631040 TGTGTTCAGCTCAAGCCTAGAGG - Intergenic
976504628 4:85832449-85832471 ATTTGTCATCTGAGGCCTTGTGG - Intronic
976527147 4:86106766-86106788 TTATTTCAGCTGTAGCCTGGTGG - Intronic
976880185 4:89912549-89912571 TTTTTTCAGCTGAGGTTTTAAGG + Intronic
976954572 4:90880000-90880022 TTTTTTGTGTTGAAGCTTTGGGG + Intronic
977218931 4:94315852-94315874 AATTTTTAGCTGAAGCCTTGAGG - Intronic
977871795 4:102099476-102099498 ATTTTTCATATGAAGCATTGAGG - Intergenic
978077531 4:104551408-104551430 TTTTTTGAGCTCATGCCTTCTGG - Intergenic
978208329 4:106105623-106105645 TTTTTTGTGTTGAAGCTTTGGGG - Intronic
979159009 4:117434912-117434934 TTGTCTCAACTGAAGTCTTGAGG + Intergenic
979192123 4:117874543-117874565 TTCTTTCAACTGAACGCTTGTGG + Intergenic
979957448 4:126971819-126971841 TTTTTTCTGCTGTGGTCTTGTGG - Intergenic
980390511 4:132139901-132139923 TTTTTTCAGCTTTAGCCTTTGGG - Intergenic
980762081 4:137247904-137247926 TTTTTGCAGCTGATACCATGGGG + Intergenic
982537563 4:156625765-156625787 CCTTTTCACCTGAAGCCTTGTGG - Intergenic
983810612 4:172056285-172056307 TCTTTTCAGGGGAAGCCTTGAGG + Intronic
984149734 4:176111926-176111948 TTTTTTCAGTTGAAGAATTTGGG + Intronic
984235234 4:177149193-177149215 TTATTTCAGCTTAAGACATGTGG + Intergenic
985342445 4:188969515-188969537 TATATTTAGCTGAAGCCCTGGGG - Intergenic
985506177 5:281878-281900 GTCTTTCAGCTGAAGACTCGGGG + Intronic
985741791 5:1621786-1621808 GTCTTGCAGCTGAAGACTTGGGG - Intergenic
985760953 5:1748412-1748434 TCTTTTCGGCTGCAGCCGTGGGG - Intergenic
986889641 5:12286024-12286046 TTTTCTCAGCTGAAGCCATTGGG + Intergenic
987048881 5:14132762-14132784 ATTTTTCAGCTGACCCCGTGAGG + Intergenic
987310038 5:16673199-16673221 TTTTTCCATAAGAAGCCTTGGGG + Intronic
989273623 5:39560883-39560905 TCTATTCAGCAGAAGCCATGTGG + Intergenic
990625953 5:57611505-57611527 TTATTTCAGTAGAAGCATTGAGG - Intergenic
991581482 5:68160026-68160048 TTTTTTCTGCAAGAGCCTTGTGG + Intergenic
992123864 5:73621790-73621812 TCTTTTCAGCTGATTCCTTAGGG - Intergenic
993851645 5:93017483-93017505 TTTTTTTATCTGAAGCCTGTAGG + Intergenic
995259348 5:110083678-110083700 TTTCTCTAGCTGAAGTCTTGGGG + Intergenic
995297449 5:110537959-110537981 TTTATTCATCTGAATCCTTTAGG + Intronic
995704390 5:114971356-114971378 TCTTTACACCTGAATCCTTGAGG + Intergenic
998065322 5:139153252-139153274 TCTTTTAAGCTGTAGCCTTTAGG - Intronic
998594711 5:143516597-143516619 TGTTTACTGCTGTAGCCTTGTGG + Intergenic
999201697 5:149821222-149821244 CTTTTTCAGCTGGAGCCTAGAGG + Intronic
999510418 5:152244782-152244804 TTGTTTCAGCTGATCCCCTGTGG - Intergenic
1000451355 5:161391971-161391993 ATTTTTCTGCTGTAGTCTTGAGG - Intronic
1001243607 5:170088797-170088819 TTGTTCCAGCTGAAGGTTTGTGG + Intergenic
1003026553 6:2559936-2559958 ATTTTTCATCTGAAGCCTCCAGG - Intergenic
1003288450 6:4756212-4756234 TTGTATCAGCTGAAGGCTTCTGG - Intronic
1004442820 6:15670231-15670253 GTTGTTAAGCTGAAGCCATGAGG - Intergenic
1004977847 6:20987956-20987978 TTTTTTCACCTGTAGACATGGGG + Intronic
1005092429 6:22071659-22071681 ATTATTCAGCTGAAGCCTTCAGG - Intergenic
1005407042 6:25500492-25500514 TATTTTATGATGAAGCCTTGAGG + Intronic
1008895236 6:56545691-56545713 TTTTATCAGCTGAAACATGGAGG + Intronic
1009694836 6:67088954-67088976 TTTTTTCCTCTGACACCTTGAGG + Intergenic
1009701709 6:67192621-67192643 TTTTATCAGGTGAAGCTTGGCGG - Intergenic
1011773940 6:90707271-90707293 TTTTGTCAGATGGGGCCTTGGGG + Intergenic
1012744242 6:103063926-103063948 TTTTTTTAGGTGAAGTCTTTAGG + Intergenic
1012792830 6:103720936-103720958 TTTTTTTAACTGGAGCCTTCAGG + Intergenic
1015365321 6:132391106-132391128 TTTTCTCACCTGAAACATTGAGG + Intronic
1015494279 6:133864716-133864738 TTTTTGGTGTTGAAGCCTTGGGG + Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1024262054 7:47580623-47580645 TTTTCTGTGCTGAGGCCTTGAGG - Intronic
1024597114 7:50947468-50947490 CTGTTTCAGCTGAAGCCTGTGGG - Intergenic
1025819423 7:64948063-64948085 CTTTTTGAGCTGAAGCATAGGGG - Intergenic
1025836450 7:65098622-65098644 TTTGTTCAGCTGAGGCCTTGGGG + Intergenic
1025906220 7:65788070-65788092 TTTGTTCAGCTGAAGCCTTGGGG + Intergenic
1026769153 7:73183106-73183128 TTTGTCCAGCGGAAGCCTTGGGG + Intergenic
1026965889 7:74439795-74439817 TTTCTCCATCTGAAGCCCTGTGG - Intergenic
1027010022 7:74736491-74736513 TTTGTCCAGCGGAAGCCTTGGGG + Intronic
1027078019 7:75209546-75209568 TTTGTCCAGCGGAAGCCTTGGGG - Intergenic
1027759544 7:82260648-82260670 TTTCTTCAGCTGTAGACTAGTGG - Intronic
1029052276 7:97701215-97701237 TTTTTTGTGTTGAAGCTTTGGGG - Intergenic
1029191498 7:98775408-98775430 TTTGTTCTACTGATGCCTTGTGG - Intergenic
1029648091 7:101870793-101870815 TGTTTTCAGCTAAAGCTGTGAGG + Intronic
1030183497 7:106735802-106735824 ATTTCTCAGCAGAAACCTTGTGG - Intergenic
1031084774 7:117291687-117291709 TTTCTTCAGTTGAAGACTAGAGG + Intronic
1031850420 7:126856497-126856519 TTTTGTCTGCAGTAGCCTTGGGG + Intronic
1035098688 7:156378641-156378663 TTTCTTCATCTGAAGACTAGTGG + Intergenic
1035289098 7:157825847-157825869 TTTTGTCTCCTGGAGCCTTGAGG - Intronic
1035495246 7:159319772-159319794 TTTTTGCATCTGAAGCCATGTGG + Intergenic
1036773534 8:11594463-11594485 GTTTTTCAGCTCTGGCCTTGGGG + Intergenic
1038681046 8:29668489-29668511 TTGTTGCAGCTGGAGCCCTGAGG + Intergenic
1039294149 8:36130959-36130981 TATTTGCAGCTGAAGCCTTTAGG + Intergenic
1040756944 8:50788004-50788026 TTTTTTCTGCAGCAGCCTTAGGG - Intronic
1042619841 8:70693320-70693342 TTTTTGCTGTTGAAGCTTTGGGG + Intronic
1043970440 8:86522801-86522823 ATTTTTCAGCTGAAGACTGAAGG + Intronic
1044567413 8:93679668-93679690 ATTTTACAGATGATGCCTTGAGG - Intergenic
1044784018 8:95775580-95775602 TTTGATCAGCTGAAACCTTGGGG - Intergenic
1045252415 8:100492916-100492938 TTTTTTCAGGACAAGCCTTGGGG - Intergenic
1047523703 8:125615163-125615185 TTTTTTCTGCTGCATCCTTGCGG + Intergenic
1048163582 8:132042216-132042238 TTTTTTCAACTTTAGACTTGGGG - Intronic
1048990703 8:139758582-139758604 TTTTATCAGCTGAACCCACGAGG - Intronic
1050944219 9:11497994-11498016 TTTATGCAGATGAAGCCTTCAGG + Intergenic
1051985127 9:23075853-23075875 TATTTTCAGTTGAACTCTTGAGG + Intergenic
1052675536 9:31617541-31617563 TTCTTTCAGCTGTAGGATTGAGG - Intergenic
1053483579 9:38434733-38434755 TTTTTTAAATTGAAGCTTTGTGG + Intergenic
1055228197 9:74027286-74027308 TTTTTTTAGCTTGAGCTTTGGGG - Intergenic
1055715021 9:79108445-79108467 TTTTTTCATCTTAAGCCTCCAGG - Intergenic
1056260597 9:84844167-84844189 TCTTTTCAGCTGCAGCATGGCGG + Intronic
1056298030 9:85212785-85212807 TTTGTTCAGCTGAATCTTTGAGG - Intergenic
1057735421 9:97654549-97654571 TTTTTTTAACTGAAGGTTTGTGG - Intronic
1058414380 9:104770866-104770888 GTTTTTCAGATGAAACCTGGTGG + Exonic
1059706926 9:116833815-116833837 TATTCGCAGTTGAAGCCTTGGGG + Intronic
1059937319 9:119323951-119323973 TTTTTTCAGGTGAAAATTTGGGG - Intronic
1186242467 X:7584460-7584482 TTATTTTAACTGAAGGCTTGTGG + Intergenic
1186530900 X:10294536-10294558 TTTTTTCTTCTGATGCCTTATGG + Intergenic
1187582914 X:20628060-20628082 TTTTTTCAGAAGAGGACTTGAGG + Intergenic
1187598540 X:20801067-20801089 TTTTATGAGCAGAACCCTTGAGG - Intergenic
1190796903 X:53754268-53754290 TTTTTTCAGTTGAAGGCTGTAGG + Intergenic
1192254243 X:69442494-69442516 TTTTTTGTGTTGAAGCTTTGGGG + Intergenic
1193236231 X:79111088-79111110 TTTTTTCAGCTGCATCCTCTGGG - Intergenic
1193331518 X:80239988-80240010 TTTTTTAGGTTGAAGCTTTGTGG + Intergenic
1193898006 X:87137762-87137784 TTTTTTATGCTGAAGTCTTTAGG - Intergenic
1201453077 Y:14137085-14137107 TTTTTTCAGCTGATGCGTTTTGG - Intergenic
1201463051 Y:14249242-14249264 TCATTTTAACTGAAGCCTTGTGG + Intergenic
1202178339 Y:22118145-22118167 TTTTTTCAGATGAAGTTCTGGGG + Intergenic
1202213022 Y:22468250-22468272 TTTTTTCAGATGAAGTTCTGGGG - Intergenic