ID: 1082294690

View in Genome Browser
Species Human (GRCh38)
Location 11:50425329-50425351
Sequence CAGGGTAAAAACTGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082294683_1082294690 1 Left 1082294683 11:50425305-50425327 CCAAAGGCGAAAAAGATAATATC No data
Right 1082294690 11:50425329-50425351 CAGGGTAAAAACTGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082294690 Original CRISPR CAGGGTAAAAACTGGAAGGA AGG Intergenic
No off target data available for this crispr