ID: 1082295281

View in Genome Browser
Species Human (GRCh38)
Location 11:50434086-50434108
Sequence CAGGATAAAAAGTAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082295276_1082295281 12 Left 1082295276 11:50434051-50434073 CCTCATTGAAGCCATTGGCAAAA No data
Right 1082295281 11:50434086-50434108 CAGGATAAAAAGTAGAAGGAAGG No data
1082295277_1082295281 1 Left 1082295277 11:50434062-50434084 CCATTGGCAAAAAAATAAATAGA No data
Right 1082295281 11:50434086-50434108 CAGGATAAAAAGTAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082295281 Original CRISPR CAGGATAAAAAGTAGAAGGA AGG Intergenic
No off target data available for this crispr