ID: 1082301043

View in Genome Browser
Species Human (GRCh38)
Location 11:50506706-50506728
Sequence ATCCAAGGATAAAAACTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082301043_1082301047 18 Left 1082301043 11:50506706-50506728 CCATCTAGTTTTTATCCTTGGAT No data
Right 1082301047 11:50506747-50506769 GGCCTCAATGAACTCCCAAATGG No data
1082301043_1082301045 -3 Left 1082301043 11:50506706-50506728 CCATCTAGTTTTTATCCTTGGAT No data
Right 1082301045 11:50506726-50506748 GATATTCTCTTTTTCTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082301043 Original CRISPR ATCCAAGGATAAAAACTAGA TGG (reversed) Intergenic
No off target data available for this crispr