ID: 1082301044

View in Genome Browser
Species Human (GRCh38)
Location 11:50506721-50506743
Sequence GGAGAAAAAGAGAATATCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082301044_1082301051 18 Left 1082301044 11:50506721-50506743 CCTTGGATATTCTCTTTTTCTCC No data
Right 1082301051 11:50506762-50506784 CCAAATGGCAATTCAAATAGTGG No data
1082301044_1082301047 3 Left 1082301044 11:50506721-50506743 CCTTGGATATTCTCTTTTTCTCC No data
Right 1082301047 11:50506747-50506769 GGCCTCAATGAACTCCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082301044 Original CRISPR GGAGAAAAAGAGAATATCCA AGG (reversed) Intergenic
No off target data available for this crispr