ID: 1082302540

View in Genome Browser
Species Human (GRCh38)
Location 11:50526819-50526841
Sequence ATATTGGCTTTATTTGCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082302540_1082302543 -2 Left 1082302540 11:50526819-50526841 CCAATTGCAAATAAAGCCAATAT No data
Right 1082302543 11:50526840-50526862 ATTCCTGGATGAAAACTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082302540 Original CRISPR ATATTGGCTTTATTTGCAAT TGG (reversed) Intergenic
No off target data available for this crispr