ID: 1082316504

View in Genome Browser
Species Human (GRCh38)
Location 11:50731358-50731380
Sequence CACAAGGAAGTTTCTGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082316501_1082316504 30 Left 1082316501 11:50731305-50731327 CCAAACTGCTGAATCAAAGGAAA No data
Right 1082316504 11:50731358-50731380 CACAAGGAAGTTTCTGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082316504 Original CRISPR CACAAGGAAGTTTCTGAGAA TGG Intergenic
No off target data available for this crispr