ID: 1082335285

View in Genome Browser
Species Human (GRCh38)
Location 11:51278077-51278099
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082335285_1082335289 -6 Left 1082335285 11:51278077-51278099 CCAAACACCCTTTCTGTAGAATC No data
Right 1082335289 11:51278094-51278116 AGAATCTGCAAGTGGATATTTGG No data
1082335285_1082335294 23 Left 1082335285 11:51278077-51278099 CCAAACACCCTTTCTGTAGAATC No data
Right 1082335294 11:51278123-51278145 CTGAGGATATCGTTGGAAAAGGG No data
1082335285_1082335291 16 Left 1082335285 11:51278077-51278099 CCAAACACCCTTTCTGTAGAATC No data
Right 1082335291 11:51278116-51278138 GACCTCTCTGAGGATATCGTTGG No data
1082335285_1082335293 22 Left 1082335285 11:51278077-51278099 CCAAACACCCTTTCTGTAGAATC No data
Right 1082335293 11:51278122-51278144 TCTGAGGATATCGTTGGAAAAGG No data
1082335285_1082335290 6 Left 1082335285 11:51278077-51278099 CCAAACACCCTTTCTGTAGAATC No data
Right 1082335290 11:51278106-51278128 TGGATATTTGGACCTCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082335285 Original CRISPR GATTCTACAGAAAGGGTGTT TGG (reversed) Intergenic
No off target data available for this crispr