ID: 1082335287

View in Genome Browser
Species Human (GRCh38)
Location 11:51278085-51278107
Sequence CACTTGCAGATTCTACAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082335287_1082335294 15 Left 1082335287 11:51278085-51278107 CCTTTCTGTAGAATCTGCAAGTG No data
Right 1082335294 11:51278123-51278145 CTGAGGATATCGTTGGAAAAGGG No data
1082335287_1082335291 8 Left 1082335287 11:51278085-51278107 CCTTTCTGTAGAATCTGCAAGTG No data
Right 1082335291 11:51278116-51278138 GACCTCTCTGAGGATATCGTTGG No data
1082335287_1082335293 14 Left 1082335287 11:51278085-51278107 CCTTTCTGTAGAATCTGCAAGTG No data
Right 1082335293 11:51278122-51278144 TCTGAGGATATCGTTGGAAAAGG No data
1082335287_1082335290 -2 Left 1082335287 11:51278085-51278107 CCTTTCTGTAGAATCTGCAAGTG No data
Right 1082335290 11:51278106-51278128 TGGATATTTGGACCTCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082335287 Original CRISPR CACTTGCAGATTCTACAGAA AGG (reversed) Intergenic
No off target data available for this crispr