ID: 1082335289

View in Genome Browser
Species Human (GRCh38)
Location 11:51278094-51278116
Sequence AGAATCTGCAAGTGGATATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082335285_1082335289 -6 Left 1082335285 11:51278077-51278099 CCAAACACCCTTTCTGTAGAATC No data
Right 1082335289 11:51278094-51278116 AGAATCTGCAAGTGGATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082335289 Original CRISPR AGAATCTGCAAGTGGATATT TGG Intergenic
No off target data available for this crispr