ID: 1082335290

View in Genome Browser
Species Human (GRCh38)
Location 11:51278106-51278128
Sequence TGGATATTTGGACCTCTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082335286_1082335290 -1 Left 1082335286 11:51278084-51278106 CCCTTTCTGTAGAATCTGCAAGT No data
Right 1082335290 11:51278106-51278128 TGGATATTTGGACCTCTCTGAGG No data
1082335287_1082335290 -2 Left 1082335287 11:51278085-51278107 CCTTTCTGTAGAATCTGCAAGTG No data
Right 1082335290 11:51278106-51278128 TGGATATTTGGACCTCTCTGAGG No data
1082335285_1082335290 6 Left 1082335285 11:51278077-51278099 CCAAACACCCTTTCTGTAGAATC No data
Right 1082335290 11:51278106-51278128 TGGATATTTGGACCTCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082335290 Original CRISPR TGGATATTTGGACCTCTCTG AGG Intergenic
No off target data available for this crispr