ID: 1082361749

View in Genome Browser
Species Human (GRCh38)
Location 11:51663062-51663084
Sequence CTGAGGATATCGTTGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082361742_1082361749 23 Left 1082361742 11:51663016-51663038 CCAAACACACTTTCTGTAGAATC No data
Right 1082361749 11:51663062-51663084 CTGAGGATATCGTTGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082361749 Original CRISPR CTGAGGATATCGTTGGAAAA GGG Intergenic
No off target data available for this crispr