ID: 1082389693

View in Genome Browser
Species Human (GRCh38)
Location 11:52069527-52069549
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082389686_1082389693 23 Left 1082389686 11:52069481-52069503 CCAAACACACTTTCTGTAGAATC No data
Right 1082389693 11:52069527-52069549 CTGAGGATATCGTTGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082389693 Original CRISPR CTGAGGATATCGTTGGAAAA GGG Intergenic
No off target data available for this crispr