ID: 1082445964

View in Genome Browser
Species Human (GRCh38)
Location 11:52883145-52883167
Sequence CTGAGGATATCGTTGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082445958_1082445964 23 Left 1082445958 11:52883099-52883121 CCAAACACACTTTTTGTAGAATC No data
Right 1082445964 11:52883145-52883167 CTGAGGATATCGTTGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082445964 Original CRISPR CTGAGGATATCGTTGGAAAA GGG Intergenic
No off target data available for this crispr