ID: 1082482015

View in Genome Browser
Species Human (GRCh38)
Location 11:53405343-53405365
Sequence CTGAGGATATCGTTGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082482008_1082482015 23 Left 1082482008 11:53405297-53405319 CCAAACACACTTTCTGTAGAATC No data
Right 1082482015 11:53405343-53405365 CTGAGGATATCGTTGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082482015 Original CRISPR CTGAGGATATCGTTGGAAAA GGG Intergenic
No off target data available for this crispr