ID: 1082482432

View in Genome Browser
Species Human (GRCh38)
Location 11:53411293-53411315
Sequence CTGAGGATATCGTTGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082482425_1082482432 15 Left 1082482425 11:53411255-53411277 CCTTTCTGTAGAATCTGCAAGTG No data
Right 1082482432 11:53411293-53411315 CTGAGGATATCGTTGGAAAAGGG No data
1082482423_1082482432 23 Left 1082482423 11:53411247-53411269 CCAAACACCCTTTCTGTAGAATC No data
Right 1082482432 11:53411293-53411315 CTGAGGATATCGTTGGAAAAGGG No data
1082482424_1082482432 16 Left 1082482424 11:53411254-53411276 CCCTTTCTGTAGAATCTGCAAGT No data
Right 1082482432 11:53411293-53411315 CTGAGGATATCGTTGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082482432 Original CRISPR CTGAGGATATCGTTGGAAAA GGG Intergenic
No off target data available for this crispr