ID: 1082510355

View in Genome Browser
Species Human (GRCh38)
Location 11:53814351-53814373
Sequence CTGAGGATATCGTTGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082510346_1082510355 23 Left 1082510346 11:53814305-53814327 CCAAACACCCTTTCTGTAGAATC No data
Right 1082510355 11:53814351-53814373 CTGAGGATATCGTTGGAAAAGGG No data
1082510347_1082510355 16 Left 1082510347 11:53814312-53814334 CCCTTTCTGTAGAATCTGCAAGT No data
Right 1082510355 11:53814351-53814373 CTGAGGATATCGTTGGAAAAGGG No data
1082510348_1082510355 15 Left 1082510348 11:53814313-53814335 CCTTTCTGTAGAATCTGCAAGTG No data
Right 1082510355 11:53814351-53814373 CTGAGGATATCGTTGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082510355 Original CRISPR CTGAGGATATCGTTGGAAAA GGG Intergenic
No off target data available for this crispr