ID: 1082512072

View in Genome Browser
Species Human (GRCh38)
Location 11:53839011-53839033
Sequence CTGAGGATATCGTTGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082512065_1082512072 15 Left 1082512065 11:53838973-53838995 CCTTTCTGTAGAATCTGCAAGTG No data
Right 1082512072 11:53839011-53839033 CTGAGGATATCGTTGGAAAAGGG No data
1082512064_1082512072 16 Left 1082512064 11:53838972-53838994 CCCTTTCTGTAGAATCTGCAAGT No data
Right 1082512072 11:53839011-53839033 CTGAGGATATCGTTGGAAAAGGG No data
1082512063_1082512072 23 Left 1082512063 11:53838965-53838987 CCAAACACCCTTTCTGTAGAATC No data
Right 1082512072 11:53839011-53839033 CTGAGGATATCGTTGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082512072 Original CRISPR CTGAGGATATCGTTGGAAAA GGG Intergenic
No off target data available for this crispr