ID: 1082519599

View in Genome Browser
Species Human (GRCh38)
Location 11:53947850-53947872
Sequence CTGTGGATTTCGTTGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082519592_1082519599 23 Left 1082519592 11:53947804-53947826 CCAAACACACTTTCTGTAGAATC No data
Right 1082519599 11:53947850-53947872 CTGTGGATTTCGTTGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082519599 Original CRISPR CTGTGGATTTCGTTGGAAAA GGG Intergenic
No off target data available for this crispr