ID: 1082545403

View in Genome Browser
Species Human (GRCh38)
Location 11:54321433-54321455
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082545396_1082545403 23 Left 1082545396 11:54321387-54321409 CCAAACACACTTTCTGTAGAATC No data
Right 1082545403 11:54321433-54321455 CTGAGGATATCGTTGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082545403 Original CRISPR CTGAGGATATCGTTGGAAAA GGG Intergenic
No off target data available for this crispr