ID: 1082588958

View in Genome Browser
Species Human (GRCh38)
Location 11:54981216-54981238
Sequence AAGAAATTGTTAACTCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082588958_1082588961 22 Left 1082588958 11:54981216-54981238 CCTCACAGAGTTAACAATTTCTT No data
Right 1082588961 11:54981261-54981283 CTGTTTTGGCAGAATCTGTGAGG No data
1082588958_1082588963 24 Left 1082588958 11:54981216-54981238 CCTCACAGAGTTAACAATTTCTT No data
Right 1082588963 11:54981263-54981285 GTTTTGGCAGAATCTGTGAGGGG No data
1082588958_1082588960 8 Left 1082588958 11:54981216-54981238 CCTCACAGAGTTAACAATTTCTT No data
Right 1082588960 11:54981247-54981269 GCAGTCTGGAAACACTGTTTTGG No data
1082588958_1082588962 23 Left 1082588958 11:54981216-54981238 CCTCACAGAGTTAACAATTTCTT No data
Right 1082588962 11:54981262-54981284 TGTTTTGGCAGAATCTGTGAGGG No data
1082588958_1082588959 -6 Left 1082588958 11:54981216-54981238 CCTCACAGAGTTAACAATTTCTT No data
Right 1082588959 11:54981233-54981255 TTTCTTTGTATATAGCAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082588958 Original CRISPR AAGAAATTGTTAACTCTGTG AGG (reversed) Intergenic
No off target data available for this crispr