ID: 1082588961

View in Genome Browser
Species Human (GRCh38)
Location 11:54981261-54981283
Sequence CTGTTTTGGCAGAATCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082588958_1082588961 22 Left 1082588958 11:54981216-54981238 CCTCACAGAGTTAACAATTTCTT No data
Right 1082588961 11:54981261-54981283 CTGTTTTGGCAGAATCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082588961 Original CRISPR CTGTTTTGGCAGAATCTGTG AGG Intergenic
No off target data available for this crispr