ID: 1082591253

View in Genome Browser
Species Human (GRCh38)
Location 11:55013546-55013568
Sequence AAGGAAAGTTTCTCTCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082591253_1082591256 8 Left 1082591253 11:55013546-55013568 CCTCACTGAGAGAAACTTTCCTT No data
Right 1082591256 11:55013577-55013599 GTAGTCTGGAAACACTGTTTTGG No data
1082591253_1082591258 23 Left 1082591253 11:55013546-55013568 CCTCACTGAGAGAAACTTTCCTT No data
Right 1082591258 11:55013592-55013614 TGTTTTGGCAGAATCCATGAGGG No data
1082591253_1082591254 -6 Left 1082591253 11:55013546-55013568 CCTCACTGAGAGAAACTTTCCTT No data
Right 1082591254 11:55013563-55013585 TTCCTTTTCATTCAGTAGTCTGG No data
1082591253_1082591259 24 Left 1082591253 11:55013546-55013568 CCTCACTGAGAGAAACTTTCCTT No data
Right 1082591259 11:55013593-55013615 GTTTTGGCAGAATCCATGAGGGG No data
1082591253_1082591257 22 Left 1082591253 11:55013546-55013568 CCTCACTGAGAGAAACTTTCCTT No data
Right 1082591257 11:55013591-55013613 CTGTTTTGGCAGAATCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082591253 Original CRISPR AAGGAAAGTTTCTCTCAGTG AGG (reversed) Intergenic
No off target data available for this crispr