ID: 1082591255

View in Genome Browser
Species Human (GRCh38)
Location 11:55013565-55013587
Sequence TTCCAGACTACTGAATGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082591255_1082591259 5 Left 1082591255 11:55013565-55013587 CCTTTTCATTCAGTAGTCTGGAA No data
Right 1082591259 11:55013593-55013615 GTTTTGGCAGAATCCATGAGGGG No data
1082591255_1082591263 25 Left 1082591255 11:55013565-55013587 CCTTTTCATTCAGTAGTCTGGAA No data
Right 1082591263 11:55013613-55013635 GGGAAATTTTGGAGCACCTTGGG No data
1082591255_1082591258 4 Left 1082591255 11:55013565-55013587 CCTTTTCATTCAGTAGTCTGGAA No data
Right 1082591258 11:55013592-55013614 TGTTTTGGCAGAATCCATGAGGG No data
1082591255_1082591264 26 Left 1082591255 11:55013565-55013587 CCTTTTCATTCAGTAGTCTGGAA No data
Right 1082591264 11:55013614-55013636 GGAAATTTTGGAGCACCTTGGGG No data
1082591255_1082591257 3 Left 1082591255 11:55013565-55013587 CCTTTTCATTCAGTAGTCTGGAA No data
Right 1082591257 11:55013591-55013613 CTGTTTTGGCAGAATCCATGAGG No data
1082591255_1082591262 24 Left 1082591255 11:55013565-55013587 CCTTTTCATTCAGTAGTCTGGAA No data
Right 1082591262 11:55013612-55013634 GGGGAAATTTTGGAGCACCTTGG No data
1082591255_1082591260 14 Left 1082591255 11:55013565-55013587 CCTTTTCATTCAGTAGTCTGGAA No data
Right 1082591260 11:55013602-55013624 GAATCCATGAGGGGAAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082591255 Original CRISPR TTCCAGACTACTGAATGAAA AGG (reversed) Intergenic
No off target data available for this crispr