ID: 1082591257 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:55013591-55013613 |
Sequence | CTGTTTTGGCAGAATCCATG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1082591253_1082591257 | 22 | Left | 1082591253 | 11:55013546-55013568 | CCTCACTGAGAGAAACTTTCCTT | No data | ||
Right | 1082591257 | 11:55013591-55013613 | CTGTTTTGGCAGAATCCATGAGG | No data | ||||
1082591255_1082591257 | 3 | Left | 1082591255 | 11:55013565-55013587 | CCTTTTCATTCAGTAGTCTGGAA | No data | ||
Right | 1082591257 | 11:55013591-55013613 | CTGTTTTGGCAGAATCCATGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1082591257 | Original CRISPR | CTGTTTTGGCAGAATCCATG AGG | Intergenic | ||
No off target data available for this crispr |