ID: 1082591257

View in Genome Browser
Species Human (GRCh38)
Location 11:55013591-55013613
Sequence CTGTTTTGGCAGAATCCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082591253_1082591257 22 Left 1082591253 11:55013546-55013568 CCTCACTGAGAGAAACTTTCCTT No data
Right 1082591257 11:55013591-55013613 CTGTTTTGGCAGAATCCATGAGG No data
1082591255_1082591257 3 Left 1082591255 11:55013565-55013587 CCTTTTCATTCAGTAGTCTGGAA No data
Right 1082591257 11:55013591-55013613 CTGTTTTGGCAGAATCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082591257 Original CRISPR CTGTTTTGGCAGAATCCATG AGG Intergenic
No off target data available for this crispr