ID: 1082599514

View in Genome Browser
Species Human (GRCh38)
Location 11:55132448-55132470
Sequence AAGCACTCACAAATATCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082599514_1082599518 29 Left 1082599514 11:55132448-55132470 CCATGGGATATTTGTGAGTGCTT No data
Right 1082599518 11:55132500-55132522 TCACCTATAAACTATAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082599514 Original CRISPR AAGCACTCACAAATATCCCA TGG (reversed) Intergenic
No off target data available for this crispr