ID: 1082599518

View in Genome Browser
Species Human (GRCh38)
Location 11:55132500-55132522
Sequence TCACCTATAAACTATAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082599514_1082599518 29 Left 1082599514 11:55132448-55132470 CCATGGGATATTTGTGAGTGCTT No data
Right 1082599518 11:55132500-55132522 TCACCTATAAACTATAAAGAAGG No data
1082599517_1082599518 1 Left 1082599517 11:55132476-55132498 CCTATGGTGATAAAGAAAATATC No data
Right 1082599518 11:55132500-55132522 TCACCTATAAACTATAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082599518 Original CRISPR TCACCTATAAACTATAAAGA AGG Intergenic
No off target data available for this crispr