ID: 1082599850

View in Genome Browser
Species Human (GRCh38)
Location 11:55135681-55135703
Sequence CATTCAAAGAAGAATATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082599847_1082599850 -6 Left 1082599847 11:55135664-55135686 CCAGAGTCTCTGGGACACATTCA 0: 17
1: 3141
2: 4665
3: 2003
4: 2288
Right 1082599850 11:55135681-55135703 CATTCAAAGAAGAATATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082599850 Original CRISPR CATTCAAAGAAGAATATGGA GGG Intergenic
No off target data available for this crispr