ID: 1082606906

View in Genome Browser
Species Human (GRCh38)
Location 11:55248713-55248735
Sequence CGCAAAGAAGTTACTGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082606903_1082606906 25 Left 1082606903 11:55248665-55248687 CCGCTCTATCAAAGGGAATGTTC No data
Right 1082606906 11:55248713-55248735 CGCAAAGAAGTTACTGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082606906 Original CRISPR CGCAAAGAAGTTACTGGGAA TGG Intergenic