ID: 1082612129

View in Genome Browser
Species Human (GRCh38)
Location 11:55312828-55312850
Sequence TGCAATCATGTCTCTTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082612129_1082612133 6 Left 1082612129 11:55312828-55312850 CCCTGTGAAGAGACATGATTGCA No data
Right 1082612133 11:55312857-55312879 CTGAGGCCTTCCCAATAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082612129 Original CRISPR TGCAATCATGTCTCTTCACA GGG (reversed) Intergenic
No off target data available for this crispr