ID: 1082618101

View in Genome Browser
Species Human (GRCh38)
Location 11:55386999-55387021
Sequence CTTGCATCATTTATAGAACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082618101_1082618104 4 Left 1082618101 11:55386999-55387021 CCTCGTTCTATAAATGATGCAAG No data
Right 1082618104 11:55387026-55387048 GGATAGAGAGCTTTAGTAAATGG No data
1082618101_1082618105 26 Left 1082618101 11:55386999-55387021 CCTCGTTCTATAAATGATGCAAG No data
Right 1082618105 11:55387048-55387070 GCCCAAAATCTCATAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082618101 Original CRISPR CTTGCATCATTTATAGAACG AGG (reversed) Intergenic
No off target data available for this crispr