ID: 1082630989

View in Genome Browser
Species Human (GRCh38)
Location 11:55541777-55541799
Sequence ATCTATAAGACCTTGATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082630989_1082630992 15 Left 1082630989 11:55541777-55541799 CCACCCATCAAGGTCTTATAGAT No data
Right 1082630992 11:55541815-55541837 GCATCAAAATTCTTTGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082630989 Original CRISPR ATCTATAAGACCTTGATGGG TGG (reversed) Intergenic
No off target data available for this crispr