ID: 1082631086

View in Genome Browser
Species Human (GRCh38)
Location 11:55543074-55543096
Sequence ATGCTCTTATTGCTTACACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082631080_1082631086 20 Left 1082631080 11:55543031-55543053 CCAAAGCCAAGAAAACCACTTTG No data
Right 1082631086 11:55543074-55543096 ATGCTCTTATTGCTTACACAAGG No data
1082631083_1082631086 5 Left 1082631083 11:55543046-55543068 CCACTTTGCTGTGTGCTGGACTG No data
Right 1082631086 11:55543074-55543096 ATGCTCTTATTGCTTACACAAGG No data
1082631077_1082631086 27 Left 1082631077 11:55543024-55543046 CCCCAATCCAAAGCCAAGAAAAC No data
Right 1082631086 11:55543074-55543096 ATGCTCTTATTGCTTACACAAGG No data
1082631081_1082631086 14 Left 1082631081 11:55543037-55543059 CCAAGAAAACCACTTTGCTGTGT No data
Right 1082631086 11:55543074-55543096 ATGCTCTTATTGCTTACACAAGG No data
1082631078_1082631086 26 Left 1082631078 11:55543025-55543047 CCCAATCCAAAGCCAAGAAAACC No data
Right 1082631086 11:55543074-55543096 ATGCTCTTATTGCTTACACAAGG No data
1082631079_1082631086 25 Left 1082631079 11:55543026-55543048 CCAATCCAAAGCCAAGAAAACCA No data
Right 1082631086 11:55543074-55543096 ATGCTCTTATTGCTTACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082631086 Original CRISPR ATGCTCTTATTGCTTACACA AGG Intergenic
No off target data available for this crispr