ID: 1082631355 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:55545915-55545937 |
| Sequence | AAGATTGTAAAGATGGAGTA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1082631355_1082631358 | 28 | Left | 1082631355 | 11:55545915-55545937 | CCTTACTCCATCTTTACAATCTT | No data | ||
| Right | 1082631358 | 11:55545966-55545988 | AGGATCTTGCTCTGTCACCCAGG | 0: 550 1: 6563 2: 26712 3: 72960 4: 132177 |
||||
| 1082631355_1082631357 | 8 | Left | 1082631355 | 11:55545915-55545937 | CCTTACTCCATCTTTACAATCTT | No data | ||
| Right | 1082631357 | 11:55545946-55545968 | TTTTTTTTTTTTTTTGATACAGG | 0: 224 1: 14301 2: 18456 3: 36929 4: 104388 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1082631355 | Original CRISPR | AAGATTGTAAAGATGGAGTA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||