ID: 1082631355

View in Genome Browser
Species Human (GRCh38)
Location 11:55545915-55545937
Sequence AAGATTGTAAAGATGGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082631355_1082631358 28 Left 1082631355 11:55545915-55545937 CCTTACTCCATCTTTACAATCTT No data
Right 1082631358 11:55545966-55545988 AGGATCTTGCTCTGTCACCCAGG 0: 550
1: 6563
2: 26712
3: 72960
4: 132177
1082631355_1082631357 8 Left 1082631355 11:55545915-55545937 CCTTACTCCATCTTTACAATCTT No data
Right 1082631357 11:55545946-55545968 TTTTTTTTTTTTTTTGATACAGG 0: 224
1: 14301
2: 18456
3: 36929
4: 104388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082631355 Original CRISPR AAGATTGTAAAGATGGAGTA AGG (reversed) Intergenic
No off target data available for this crispr