ID: 1082631540

View in Genome Browser
Species Human (GRCh38)
Location 11:55548174-55548196
Sequence ATGTGTCAAGTGCCATCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082631540_1082631545 27 Left 1082631540 11:55548174-55548196 CCATAGGATGGCACTTGACACAT No data
Right 1082631545 11:55548224-55548246 TATAACAAAATGAAAGCTGGTGG No data
1082631540_1082631544 24 Left 1082631540 11:55548174-55548196 CCATAGGATGGCACTTGACACAT No data
Right 1082631544 11:55548221-55548243 TGTTATAACAAAATGAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082631540 Original CRISPR ATGTGTCAAGTGCCATCCTA TGG (reversed) Intergenic