ID: 1082631540 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:55548174-55548196 |
| Sequence | ATGTGTCAAGTGCCATCCTA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1082631540_1082631544 | 24 | Left | 1082631540 | 11:55548174-55548196 | CCATAGGATGGCACTTGACACAT | No data | ||
| Right | 1082631544 | 11:55548221-55548243 | TGTTATAACAAAATGAAAGCTGG | No data | ||||
| 1082631540_1082631545 | 27 | Left | 1082631540 | 11:55548174-55548196 | CCATAGGATGGCACTTGACACAT | No data | ||
| Right | 1082631545 | 11:55548224-55548246 | TATAACAAAATGAAAGCTGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1082631540 | Original CRISPR | ATGTGTCAAGTGCCATCCTA TGG (reversed) | Intergenic | ||