ID: 1082631544

View in Genome Browser
Species Human (GRCh38)
Location 11:55548221-55548243
Sequence TGTTATAACAAAATGAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082631542_1082631544 -7 Left 1082631542 11:55548205-55548227 CCCAGTAAACAGCAGCTGTTATA No data
Right 1082631544 11:55548221-55548243 TGTTATAACAAAATGAAAGCTGG No data
1082631540_1082631544 24 Left 1082631540 11:55548174-55548196 CCATAGGATGGCACTTGACACAT No data
Right 1082631544 11:55548221-55548243 TGTTATAACAAAATGAAAGCTGG No data
1082631543_1082631544 -8 Left 1082631543 11:55548206-55548228 CCAGTAAACAGCAGCTGTTATAA No data
Right 1082631544 11:55548221-55548243 TGTTATAACAAAATGAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082631544 Original CRISPR TGTTATAACAAAATGAAAGC TGG Intergenic