ID: 1082632449

View in Genome Browser
Species Human (GRCh38)
Location 11:55558243-55558265
Sequence CGGCCTCTTTCTCGATTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082632449_1082632455 28 Left 1082632449 11:55558243-55558265 CCTGAAAATCGAGAAAGAGGCCG No data
Right 1082632455 11:55558294-55558316 CTGGGATGCTTTCTGTTTACAGG No data
1082632449_1082632453 9 Left 1082632449 11:55558243-55558265 CCTGAAAATCGAGAAAGAGGCCG No data
Right 1082632453 11:55558275-55558297 TATGTGCAGTAACGTCAGACTGG No data
1082632449_1082632454 10 Left 1082632449 11:55558243-55558265 CCTGAAAATCGAGAAAGAGGCCG No data
Right 1082632454 11:55558276-55558298 ATGTGCAGTAACGTCAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082632449 Original CRISPR CGGCCTCTTTCTCGATTTTC AGG (reversed) Intergenic
No off target data available for this crispr