ID: 1082640552

View in Genome Browser
Species Human (GRCh38)
Location 11:55654777-55654799
Sequence ACAGAGTGTCTATACTGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082640552_1082640556 15 Left 1082640552 11:55654777-55654799 CCTTGCCAGTATAGACACTCTGT No data
Right 1082640556 11:55654815-55654837 GCCATCACTGGAATATCCTTAGG No data
1082640552_1082640558 19 Left 1082640552 11:55654777-55654799 CCTTGCCAGTATAGACACTCTGT No data
Right 1082640558 11:55654819-55654841 TCACTGGAATATCCTTAGGCTGG No data
1082640552_1082640555 3 Left 1082640552 11:55654777-55654799 CCTTGCCAGTATAGACACTCTGT No data
Right 1082640555 11:55654803-55654825 TGTGCTTATTGTGCCATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082640552 Original CRISPR ACAGAGTGTCTATACTGGCA AGG (reversed) Intergenic
No off target data available for this crispr