ID: 1082640555

View in Genome Browser
Species Human (GRCh38)
Location 11:55654803-55654825
Sequence TGTGCTTATTGTGCCATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082640551_1082640555 18 Left 1082640551 11:55654762-55654784 CCAAGCATAAAACATCCTTGCCA No data
Right 1082640555 11:55654803-55654825 TGTGCTTATTGTGCCATCACTGG No data
1082640553_1082640555 -2 Left 1082640553 11:55654782-55654804 CCAGTATAGACACTCTGTCCATG No data
Right 1082640555 11:55654803-55654825 TGTGCTTATTGTGCCATCACTGG No data
1082640550_1082640555 19 Left 1082640550 11:55654761-55654783 CCCAAGCATAAAACATCCTTGCC No data
Right 1082640555 11:55654803-55654825 TGTGCTTATTGTGCCATCACTGG No data
1082640552_1082640555 3 Left 1082640552 11:55654777-55654799 CCTTGCCAGTATAGACACTCTGT No data
Right 1082640555 11:55654803-55654825 TGTGCTTATTGTGCCATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082640555 Original CRISPR TGTGCTTATTGTGCCATCAC TGG Intergenic
No off target data available for this crispr