ID: 1082640556

View in Genome Browser
Species Human (GRCh38)
Location 11:55654815-55654837
Sequence GCCATCACTGGAATATCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082640551_1082640556 30 Left 1082640551 11:55654762-55654784 CCAAGCATAAAACATCCTTGCCA No data
Right 1082640556 11:55654815-55654837 GCCATCACTGGAATATCCTTAGG No data
1082640553_1082640556 10 Left 1082640553 11:55654782-55654804 CCAGTATAGACACTCTGTCCATG No data
Right 1082640556 11:55654815-55654837 GCCATCACTGGAATATCCTTAGG No data
1082640554_1082640556 -8 Left 1082640554 11:55654800-55654822 CCATGTGCTTATTGTGCCATCAC No data
Right 1082640556 11:55654815-55654837 GCCATCACTGGAATATCCTTAGG No data
1082640552_1082640556 15 Left 1082640552 11:55654777-55654799 CCTTGCCAGTATAGACACTCTGT No data
Right 1082640556 11:55654815-55654837 GCCATCACTGGAATATCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082640556 Original CRISPR GCCATCACTGGAATATCCTT AGG Intergenic
No off target data available for this crispr