ID: 1082640558

View in Genome Browser
Species Human (GRCh38)
Location 11:55654819-55654841
Sequence TCACTGGAATATCCTTAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082640553_1082640558 14 Left 1082640553 11:55654782-55654804 CCAGTATAGACACTCTGTCCATG No data
Right 1082640558 11:55654819-55654841 TCACTGGAATATCCTTAGGCTGG No data
1082640552_1082640558 19 Left 1082640552 11:55654777-55654799 CCTTGCCAGTATAGACACTCTGT No data
Right 1082640558 11:55654819-55654841 TCACTGGAATATCCTTAGGCTGG No data
1082640554_1082640558 -4 Left 1082640554 11:55654800-55654822 CCATGTGCTTATTGTGCCATCAC No data
Right 1082640558 11:55654819-55654841 TCACTGGAATATCCTTAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082640558 Original CRISPR TCACTGGAATATCCTTAGGC TGG Intergenic
No off target data available for this crispr