ID: 1082641186

View in Genome Browser
Species Human (GRCh38)
Location 11:55663551-55663573
Sequence TCTCATCTGCAGTATAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082641186_1082641189 -9 Left 1082641186 11:55663551-55663573 CCATCCTTATACTGCAGATGAGA No data
Right 1082641189 11:55663565-55663587 CAGATGAGAAAACCAGGTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082641186 Original CRISPR TCTCATCTGCAGTATAAGGA TGG (reversed) Intergenic
No off target data available for this crispr