ID: 1082644469

View in Genome Browser
Species Human (GRCh38)
Location 11:55704483-55704505
Sequence TCTTATAGGCAGAAGATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082644469_1082644474 22 Left 1082644469 11:55704483-55704505 CCATCTATCTTCTGCCTATAAGA No data
Right 1082644474 11:55704528-55704550 ACATATACATTTTAAAATATGGG No data
1082644469_1082644471 -3 Left 1082644469 11:55704483-55704505 CCATCTATCTTCTGCCTATAAGA No data
Right 1082644471 11:55704503-55704525 AGAGACACACTTCACCTATAAGG No data
1082644469_1082644473 21 Left 1082644469 11:55704483-55704505 CCATCTATCTTCTGCCTATAAGA No data
Right 1082644473 11:55704527-55704549 AACATATACATTTTAAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082644469 Original CRISPR TCTTATAGGCAGAAGATAGA TGG (reversed) Intergenic
No off target data available for this crispr