ID: 1082649831

View in Genome Browser
Species Human (GRCh38)
Location 11:55776128-55776150
Sequence CAGGGTAAACAGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082649826_1082649831 6 Left 1082649826 11:55776099-55776121 CCATGATGGACTTTTGCTATAGA No data
Right 1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG No data
1082649824_1082649831 28 Left 1082649824 11:55776077-55776099 CCTAGAAGCGATGGGTTTTCTTC No data
Right 1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082649831 Original CRISPR CAGGGTAAACAGAGGGAAGC AGG Intergenic
No off target data available for this crispr