ID: 1082652949

View in Genome Browser
Species Human (GRCh38)
Location 11:55817179-55817201
Sequence AAGACTATTGTTCAGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082652949_1082652958 29 Left 1082652949 11:55817179-55817201 CCTGACTCCTGAACAATAGTCTT No data
Right 1082652958 11:55817231-55817253 AGAAGAGCTTTGAGAATATTAGG No data
1082652949_1082652955 1 Left 1082652949 11:55817179-55817201 CCTGACTCCTGAACAATAGTCTT No data
Right 1082652955 11:55817203-55817225 TGAAAACAGGTACCTGGGATGGG No data
1082652949_1082652956 2 Left 1082652949 11:55817179-55817201 CCTGACTCCTGAACAATAGTCTT No data
Right 1082652956 11:55817204-55817226 GAAAACAGGTACCTGGGATGGGG No data
1082652949_1082652952 -5 Left 1082652949 11:55817179-55817201 CCTGACTCCTGAACAATAGTCTT No data
Right 1082652952 11:55817197-55817219 GTCTTATGAAAACAGGTACCTGG No data
1082652949_1082652954 0 Left 1082652949 11:55817179-55817201 CCTGACTCCTGAACAATAGTCTT No data
Right 1082652954 11:55817202-55817224 ATGAAAACAGGTACCTGGGATGG No data
1082652949_1082652953 -4 Left 1082652949 11:55817179-55817201 CCTGACTCCTGAACAATAGTCTT No data
Right 1082652953 11:55817198-55817220 TCTTATGAAAACAGGTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082652949 Original CRISPR AAGACTATTGTTCAGGAGTC AGG (reversed) Intergenic
No off target data available for this crispr