ID: 1082652953

View in Genome Browser
Species Human (GRCh38)
Location 11:55817198-55817220
Sequence TCTTATGAAAACAGGTACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082652949_1082652953 -4 Left 1082652949 11:55817179-55817201 CCTGACTCCTGAACAATAGTCTT No data
Right 1082652953 11:55817198-55817220 TCTTATGAAAACAGGTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082652953 Original CRISPR TCTTATGAAAACAGGTACCT GGG Intergenic
No off target data available for this crispr