ID: 1082653560

View in Genome Browser
Species Human (GRCh38)
Location 11:55824711-55824733
Sequence GATCTCTGTGGGATATCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082653560_1082653565 9 Left 1082653560 11:55824711-55824733 CCATTTGATATCCCACAGAGATC No data
Right 1082653565 11:55824743-55824765 TTTGGGAAGCTTATGAAACATGG No data
1082653560_1082653564 -8 Left 1082653560 11:55824711-55824733 CCATTTGATATCCCACAGAGATC No data
Right 1082653564 11:55824726-55824748 CAGAGATCAGTGATTGTTTTGGG No data
1082653560_1082653566 10 Left 1082653560 11:55824711-55824733 CCATTTGATATCCCACAGAGATC No data
Right 1082653566 11:55824744-55824766 TTGGGAAGCTTATGAAACATGGG No data
1082653560_1082653563 -9 Left 1082653560 11:55824711-55824733 CCATTTGATATCCCACAGAGATC No data
Right 1082653563 11:55824725-55824747 ACAGAGATCAGTGATTGTTTTGG No data
1082653560_1082653568 18 Left 1082653560 11:55824711-55824733 CCATTTGATATCCCACAGAGATC No data
Right 1082653568 11:55824752-55824774 CTTATGAAACATGGGCCCCAGGG No data
1082653560_1082653567 17 Left 1082653560 11:55824711-55824733 CCATTTGATATCCCACAGAGATC No data
Right 1082653567 11:55824751-55824773 GCTTATGAAACATGGGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082653560 Original CRISPR GATCTCTGTGGGATATCAAA TGG (reversed) Intergenic
No off target data available for this crispr