ID: 1082653590

View in Genome Browser
Species Human (GRCh38)
Location 11:55824997-55825019
Sequence CTCCAGAAGGGGAATTCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082653584_1082653590 21 Left 1082653584 11:55824953-55824975 CCTGATGTGTTTTCCTCATGGAG No data
Right 1082653590 11:55824997-55825019 CTCCAGAAGGGGAATTCAAAAGG No data
1082653586_1082653590 8 Left 1082653586 11:55824966-55824988 CCTCATGGAGGTAGCTTATTATA No data
Right 1082653590 11:55824997-55825019 CTCCAGAAGGGGAATTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082653590 Original CRISPR CTCCAGAAGGGGAATTCAAA AGG Intergenic
No off target data available for this crispr