ID: 1082655577

View in Genome Browser
Species Human (GRCh38)
Location 11:55852642-55852664
Sequence CCTCATCTAATTTAGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082655572_1082655577 -8 Left 1082655572 11:55852627-55852649 CCACACATACCCAGACCTCATCT No data
Right 1082655577 11:55852642-55852664 CCTCATCTAATTTAGCTGGCTGG No data
1082655571_1082655577 1 Left 1082655571 11:55852618-55852640 CCAGGTGTACCACACATACCCAG No data
Right 1082655577 11:55852642-55852664 CCTCATCTAATTTAGCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082655577 Original CRISPR CCTCATCTAATTTAGCTGGC TGG Intergenic
No off target data available for this crispr